Intramacronucleata

Показать простейших в этой категории

Cariacothrix

With an archway-shaped kinety surrounding the oral opening and extending to posterior body end; with a unique molecular signature ‘GAAACAGUCGGGGGUAUCAGUA’ (spanning nucleotide positions 283-305 in GenBank accession number GU819615); con-firmed only from deep waters of anoxic Cariaco Basin, Venezuela. Cariacothrix caudata.

Spirotrichea

Conspicuous right and left oral and/or preoral ciliature; left serial oral polykinetids leading, usually clockwise into the oral cavity, either around a broad anterior end or along anterior and left margins of the body; DNA replication in the macronucleus accomplished by a complicated migrating structure called a replication band in all but Protocruzia and Phacodinium.

Armophorea

Typically dependent upon methanogenic endosymbionts, suggesting that hydrogenases within this group may be monophyletic.

Litostomatea

Somatic monokinetids with two transverse ribbons, a slightly convergent postciliary ribbon, and a laterally directed kinetodesmal fibril that does not overlap those of adjacent kineties; one transverse ribbon tangential to the kinetosome perimeter and extending anteriorly into the somatic ridge to the left of the kinetid and the other transverse ribbon radial to the kinetosome perimeter and extending transversely into the adjacent somatic ridge.

Conthreep

Group identified by SSU rRNA phylogenies. With a node-based definition: the clade stemming from the most recent common ancestor of the Colpodea (C), Oligohymenophorea (O), Nassophorea (N), Phyllopharyngea (P), Prostomatea (P), and Plagiopylea (P), hence CONthreeP. «Ventrata» suggests a «ventral» morphological synapomorphy for the group but this does not exist

Поиск на других архивах:

Ярославская обл., п. Борок, ИБВВ РАН

protist-rffi@yandex.ru

(48547) 245 33

Сайт protist.ru разработан при поддержке РФФИ № 15-29-02518 офи_м «Создание интегрированной информационной web-системы по биоразнообразию протистов». Направление работы проекта входит в перечень приоритетных направлений развития технологической платформы «Биотех2030»

Copyright © 2018